transcriptional repressor (CcpN family) of gluconeogenetic genes and of sr1. repression in the presence of glucose

transcriptional repressor (CcpN family) of gluconeogenetic genes and of [[gene|sr1]], repression in the presence of glucose, involved in the control of cell elongation

BSU25250

BSU_25250

636

639

BSU25250

BSU_25250

2,604,959 → 2,605,597

2,604,959 2,605,597

2 [SW|CBS domain]s (83-139, 148-211)

[SW|HTH deoR-type domain] (aa 6-70) (according to UniProt)

2 [SW|CBS domain]s (aa 83-139, aa 148-211) (according to UniProt)

MGNA-C493 (yqzB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2491 NBRP B. subtilis, Japan]

DB104 ''ccpN''::cat, available in [SW|Sabine Brantl]'s lab

GP1128 ''ccpN''::cat, available in [SW|Jörg Stülke]'s lab

BKE25250 (Δ[[gene|ccpN]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCACCTTTTCACTTCATA, downstream forward: _UP4_TAAGATTGCAAACTAACGGG

BKK25250 (Δ[[gene|ccpN]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCACCTTTTCACTTCATA, downstream forward: _UP4_TAAGATTGCAAACTAACGGG

MGNA-C493 (yqzB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2491 NBRP B. subtilis, Japan]

DB104 ''ccpN''::cat, available in [SW|Sabine Brantl]'s lab

GP1128 ''ccpN''::cat, available in [SW|Jörg Stülke]'s lab

BKE25250 ([[gene|ccpN]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCACCTTTTCACTTCATA, downstream forward: _UP4_TAAGATTGCAAACTAACGGG

BKK25250 ([[gene|ccpN]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCACCTTTTCACTTCATA, downstream forward: _UP4_TAAGATTGCAAACTAACGGG

[SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France

[SW|Sabine Brantl], Bacterial Genetics, Friedrich-Schiller-University of Jena, Germany [http://www.uni-jena.de/AG_Bakteriengenetik_(_Doz__Dr__Sabine_Brantl_).html homepage]

[SW|Uwe Sauer], ETH Zürich, Switzerland [http://www.imsb.ethz.ch/researchgroup/sauer homepage]

[SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France

[SW|Sabine Brantl], Bacterial Genetics, Friedrich-Schiller-University of Jena, Germany [http://www.uni-jena.de/AG_Bakteriengenetik_(_Doz__Dr__Sabine_Brantl_).html homepage]

[SW|Uwe Sauer], ETH Zrich, Switzerland [http://www.imsb.ethz.ch/researchgroup/sauer homepage]

15720552, 16164558, 17011578, 18511073, 18586936, 19726675, 19732150, 22190493, 23280112

15720552, 16164558, 17011578, 18511073, 18586936, 19726675, 19732150, 22190493, 23280112, 32762636

[[this]]

[PDB|3FV6] (the [SW|CBS domain]s, aa 63 ... 212)